Solid lines on the right indicate possible clades. Chlorophyta are a paraphyletic group. The intron was removed from the rbcL gene sequences before analysis. This maximum reflects the accumulation of caulerpenyne at the wounded site as well as the presence of caulerpenyne derivatives within the wound plug. Here, we reveal distinct differences between the species in the chemical composition of the wound plug region with respect to the protein cross-linking derivatives of caulerpenyne. [Keywords: Caulerpa, Marine Macroalgae, Morphology Variation, Indian coast, Intertidal area.] For example, C. serrulata and C. cupressoides showed paraphyly in tufA analysis but formed a sister lineage in ITS rDNA analysis. Morhac, A. In this work, we introduce a comparative Raman spectroscopic study of the wound plug formation in the invasive Caulerpa taxifolia (Valh) Agardh, 1817 and the non-invasive Caulerpa prolifera J.V. This strategy of asexual reproduction is particularly remarkable considering that Caulerpa species can reach meters in length with a unicellular siphonous organization. Ecosyst. PCR products were purified and subjected to commercial sequencing (Macrogen Inc., Korea). For example, the incongruity was observed in the position of C. flexilis as it formed a separate lineage in tufA gene analysis and clustered with C. okamurae, C. microphysa and C. lentillifera in the rbcL gene phylogenetic tree. A new species, C. veravalensis, containing narrow, linear, non-overlapping, flat pinnules with a rounded apex was described from Veraval, Gujarat, India [10]. Biofouling 28: 687–696. This study highlights that the growth and morphological variation of Caulerpaspp. The study supports the use of the tufA gene as a preferred marker with the monophyletic association of taxa as the main criteria for identification at the species level. racemosa f. remota Coppejans described by Coppejans et al. In conclusion, the first occurrence of ... Caulerpa macrodisca KF256095 Belton et al. The cellwall or frustule of diatoms consists of two overlapping halves (like the halves of a petridish) and is made of silica. Boudouresque, D. Chiaverini, F. Cinelli, J.M. The use of molecular markers for identification and phylogenetic studies of the genus Caulerpa from India has not been reported to date. Hawthorne and B.R. The 18S nuclear rDNA has been widely used in phylogenetic studies since it comprises highly conserved regions among the species and shows a high degree of functional constancy with a slow evolutionary rate. There, the dominant Raman band appeared at the same spectral position as that in caulerpenyne. Anchors aweigh: fragment generation of invasive Caulerpa taxifolia by boat anchors and its resistance to desiccation. Note, however, that these algae are coenocytic, i.e. 2002. Protoplasma 110: 129–137. In the rbcL-gene-based analysis, the position of certain taxa did not resolve sufficiently and also showed incongruence with other datasets. 2005. Being a peninsular country, India has a long coastline (8129 km), with various kinds of habitats which support vast number of flora and fauna. These insertion sequences were reported by Kooistra [40] in two Caulerpacean specimens, and were utilized by Durand et al. The relatively conserved tufA gene is a preferred marker for identification and phylogeny of green algal taxa [18,23,36]. The highest divergence was observed for the C. verticillata with a mean genetic distance 0.160 (0.147-0.173). cylindracea f. laxa (C05 and C20) and C. veravalensis (C10 and C23) clustered together. Rapid biopolymerisation during wound plug formation in green algae. This can be further substantiated by the fact that out of 359 species (including forms and varieties) in the genus Caulerpa, only 85 are taxonomically valid [1]. Wound closure in the invasive green alga Caulerpa taxifolia by enzymatic activation of a protein cross-linker. broad scope, and wide readership – a perfect fit for your research every time. Reduction of herbivory through wound-activated protein cross-linking by the invasive macroalga. Support values at nodes correspond to posterior probabilities (pp). G.P. 2008. Dreher and B.R. After 2–5 min, when the wound plug was fully developed, the individuals were mounted on a silica glass slide and wet with seawater. Upon wounding of C. taxifolia and C. prolifera, the main secondary metabolite caulerpenyne is enzymatically transformed to oxytoxin 2, which crosslinks algal proteins (Figure 1. 50: 7691–7694. . All spectra were analyzed using R (R Development Core Team 2010). The two species, Caulerpa taxifolia and Caulerpa prolifera, grow in the Mediterranean Sea, but while C. prolifera belongs to the native vegetation, C. taxifolia is an invasive species (Williams 2007). The rbcL phylogeny (Figure 5) was not consistent with the phylogeny of other datasets. 2005). Variations in the Structure, Morphology and Biomass of Caulerpa taxifolia in the Mediterranean Sea Fatty Acid Composition of Green Algae of the Genus Caulerpa Impact of UV-A and UV-B Irradiance on the Patterns of Pigments and 15N-Ammonium Assimilation of the Tropical Marine Diatom Bellerochea yucatanensis Grant. Analysis of the cytochrome distribution via linear and nonlinear Raman spectroscopy. Sample ID for specimens from this study and accession numbers for the reference sequences are given for identification in Table S1. Comparison of the wound-activated transformation of caulerpenyne by invasive and noninvasive, Meinesz, A., T. Belsher, T. Thiebaut, B. Antolic, K. Ben Mustapha, C.F. The molecular marker ITS rDNA shows high variability in its sequence as well as in its length, which can be exploited for comparing the Caulerpa populations at the inter- and intraspecific levels [19]. In contrast, the faster wound-activated transformation of caulerpenyne in C. prolifera might be due to the absence of an external wound plug forming an initial barrier. In this comparative study of wound plug formation, more subtle differences in wound plug chemistry were demonstrated at species level within the genus Caulerpa. Some genus of brown (e.g. peltata FM956055 Darisma and Prud’homme van … The NJ tree (Figure 1) revealed the presence of 19 distinct well-supported clades. Effects of Light Intensity on the Morphology and Productivity of Caulerpa racemosa (ForsskaI) J. Agardh' RUSSELL D. PETERSON~ Abstract Six varieties and three additional growth forms of Caulerpa racemosa (Forsskal) J. Ag. The average corrected divergence over all sequence pairs was 0.063. The present results also agree with the study of Olsen et al. In view of this, these two taxa were excluded from the interspecific variation range. The collection sites for the specimens included in this study are shown in Figure S1. The comparative study presented here follows up a first report on the wound plug formation of C. taxifolia (Weissflog et al. Journal of Applied Phycology 5:141-147 However, there is a single valid ITS rDNA sequence available for C. cupressoides in GenBank dataset and more sequences will be required for differentiating the C. cupressioides and C. serrulata as monophyletic lineages. Nature 408: 157–158. The models were selected based on the Bayesian Information Criterion (BIC) [64] scores for each dataset (Table 2). If the inline PDF is not rendering correctly, you can download the PDF file here. The present study thus investigates the utility of tufA, rbcL and ITS rDNA by standard barcode methods (Neighbour-joining (NJ) analysis and nucleotide-sequence divergences) as described by Hebert et al. form a polymer wound plug that seals their giant cells after mechanical injury, in order to prevent fatal loss of cell material. For the plots showing the Raman intensities of characteristic bands vs. the distance from the cut, the integrated intensities of those bands were calculated for each spectrum and related to the distance of each measurement point from the cut. Samples were cleaned with sterile seawater to remove mud and epiphytes and finally rinsed with distilled water. 2007. J. Chem. : e47728. However, these studies largely consisted of collections made from the southern part only. 94°C ⁄ 5 min; 35cyclesof 94°C ⁄ 1min, 52.4°C ⁄ 1 min 72°C ⁄ 2min; final extension 72°C ⁄ 5 min, 94°C ⁄ 5 min; 35 cycles of 94°C ⁄ 1 min, 52.4°C ⁄ 1 min, 72°C ⁄2 min; final extension 72°C ⁄5 min, 94°C ⁄ 5 min; 35 cycles of 94°C ⁄ 45 sec, 41.5°C ⁄ 45 sec, 72°C ⁄2 min; final extension 72°C ⁄10 min, 94°C ⁄ 5 min; 35 cycles of 94°C ⁄ 1 min, 50°C ⁄ 1 min, 72°C ⁄2 min; final extension 72°C ⁄5 min, p1 = 1-1076\3 p2 = 2-1076\3 p3 = 3-1076\3. Walter, A., S. Erdmann, T. Bocklitz, E.M. Jung, N. Vogler, D. Akimov, B. Dietzek, P. Rösch, E. Kothe and J. Popp. These findings indicate that caulerpenyne is actively involved in the wound sealing reaction. In this study, C. prolifera individuals have been observed to have lost cell material for almost half a minute before the wound plug seals the cut. The 50 per cent majority rule consensus tree was obtained after discarding 25% of sampled trees as burn-in. Below: Chemical structure of β-carotene. Subsequently, Svedelius [7] investigated the biodiversity of Caulerpa from Ceylon (Sri Lanka) following the work of Agardh [8]. Vienna, Austria. : Caulerpa wound plug chemistry and morphology 2240 1450 1500 1550 1600 1650 1700 1750 Figure 3The averaged spectrum of the wound plug of Caulerpa prolifera (A), and the external (B) and internal (C) wound plugs of C. taxifolia. small DNA sequences amplified and sequenced from a standardized portion of the genome to identify and discriminate species. Morphological description and images of Caulerpa specimens collected for this study. Therefore, for truly understanding the placement in phylogenetic tree and proper identification of different populations of C. scalpelliformis, C. serrulta and C. cupressoides more detailed study with other molecular markers will be required. Thus, conventional diagnostic characters alone have rather limited application when determining the correct identification and phylogeny of the species. Caulerpa racemosa (Forsskal) J. Agardh is a siphonaceous green alga exhibit­ ing an extreme degree of variation in its growth form. These signals cannot be assigned to specific chemical structures but can be considered as characteristics of the wound plug of the algae. The spectra were averaged after sorting into different zones. The position of C. serrulata (C18) was clearly paraphyletic in the BI tree. Therefore, intensive sampling was performed mainly from these areas. lycopodium (AJ512470) was poorly supported among these clusters. [2-4]. Being a peninsular country, India has a long coastline (8129 km), with various kinds of habitats which support vast number of flora and fauna. Caulerpella ambigua was used as an outgroup in tufA and rbcL tree as it was found to be the most basal taxon to all the Caulerpa species [23,28]. The major addition to these phylogenetic analyses was C. veravalensis, which was recovered as a sister lineage to C. racemosa var. Caulerpa (Caulerpa taxifolia)seaweed is a unicellular, marine, green alga found in tropical to subtropical regions, in both shallow lagoons and deeper coastal waters at depths of up to 46 meters. In these rare cases, the band of the carbon triple bond is found in half of the spectra at 2172 cm-1 or as a shoulder of the band at 2187 cm-1 in the second half of the spectra. Dreher and B.R. [17] and Fama et al. Distribution of the Japanese edible alga, Caulerpa lentillifera J. Agardh (Chrolophyceae), was determined by field survey during 2005 to 2011, and observations of its morphology and habitat characteristics were included. Moreover, the rate of evolution is variable for different molecular markers; therefore to resolve the phylogenetic relationship it usually requires extensive sequencing of multiple molecular markers. 2001. The rate variation among sites was modelled with a gamma distribution (shape parameter = 5). Mediterranean species of. Botanica Marina 38:499-508 Meinesz A, de Vaugelas J, Hesse B, Mari X (1993) Spread of the introduced tropical green alga Caulerpa taxifolia in northern Mediterranean waters. The minimum for this band appears around zone 2. C03 and C13, consistently placed in the same clade with C. veravalensis in all the phylogenetic trees. 2013), while corresponding bands in the wound plug of C. prolifera were found at 1556, 1572 and 1627 cm-1. (2014) Caulerpa peltata var. The length of insertion sequence in 18S rDNA sequence was found to be in the range of 113-115 nucleotides in Caulerpa species. In NJ analysis of tufA and ITS rDNA, most of the clades were recovered as being monophyletic with strong support with few exceptions. Funding: The financial assistance received from Council of Scientific and Industrial Research (www.csir.res.in), New Delhi (CSC0116: BioEn) is duly acknowledged. Box, A., A. Sureda, P. Tauler, J. Terrados, N. Marbà, A. Pons and S. Daudero. Performed the experiments: MAK CRKR BJ. Adolph, S., V. Jung, J. Rattke and G. Pohnert. However, these sub-specific ranks can be delineated by using longer nucleotide sequences [71] or detailed transcriptome analyses [72]. [66]. 2012. The morphological characters of collected specimens were studied by following the traditional taxonomic keys for the genus Caulerpa. In contrast, the C. taxifolia individuals do not show any leakage. 2000, Meinesz et al. Introduced species in seagrass ecosystems: status and concerns. These taxa may be considered as part of a new C. veravalensis complex and need further detailed investigations. The C. racemosa and varieties were positioned in four different lineages. The average intraspecific genetic divergence was 0.003 and the average interspecific divergence was 0.068. : Mar. However, FT-Raman spectra already indicate that there are distinct differences in both the morphologies and chemical compositions of the wound plugs of different Caulerpa spp. The species that was identified as C. racemosa var. Most of the tropical Siphonales are calcified which, in a way, provide the mechanical support to the thallus (e.g., Halimeda). 2011). C. microphysa (C06) and C. lentillifera (C14) showed no sequence difference and clustered together. Coppejans and Beeckman [69] considered C. lentillifera and C. microphysa as separate species. Wrote the manuscript: MAK CRKR BJ. 2011. Morphology of Caulerpa taxifolia a: frond b: pinnules c: secondary frond d: stolon e: rhizoidal bouquet f: rhizoidal pillars g: rachis adapted from D. Chiaverini, LEML Photo: N. Coleman, World of Water Caulerpa taxifolia legislation In December 1994, scientists assigned to study the problem by the European Commission, issued the "Barcelona Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. [28]. 2009) but also more subtle differences at the species level. laetevirens (AJ512415) clustered with C. peltata (C19 and C28) with very strong support (pp=1.0). The branches are a few centimetres apart and can grow to a height of 30 centimetres (12 in). Seasonality of caulerpenyne content in native, Dreher, T.W., D.B. Herbert et al. Within similar regions, spectra were averaged and areas with distinct chemical compositions were classified. The results of phylogenetic analysis were consistent with the study of Yeh and Chen [26], as C. microphysa deviated from other species proving its taxonomic distinction. The lower interspecific genetic distance was observed in some of the taxonomically well-established species. Furthermore, these two taxa showed no difference in rbcL gene sequence. Mar.53: 367–375. [17] showed the topological differences between phylogenies inferred from tufA and rbcL genes for the genus Caulerpa. However, the band appeared very weak in contrast to the internal wound plug of C. taxifolia. Dreher, T.W., D.B. The Raman spectra reveal a zonation of the wound plug of C. taxifolia into four chemically distinguishable regions, while that of C. prolifera consists of only three regions with specific chemical composition. Varela-Álvarez, E., A.G. Garreta, J.R. Lluch, N.S. The biodiversity assessment study from the Gujarat coast reported the occurrence of 14 species including five varieties and three forms [14]. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. Protoplasma105: 195–206. Introduction . Phylogenetic trees were constructed by Bayesian inference (BI) using MrBayes v.3.1.2 [60]. Caulerpenyne and caulerpenyne transformation product derived signals are indicated by #, carotene derived signals by *. Mar. PLOS is a nonprofit 501(c)(3) corporation, #C2354500, based in San Francisco, California, US. The very weak band of the carbon triple bond in this region suggests that mechanisms other than cross-linking between caulerpenyne derivatives and proteins may be responsible for polymer formation. Both stressed the need for knowledge of the relation between habitat and morphological organization. Gametophytic Phase of Marchantia 4. Includes Figures S1-S19. These are characteristic of caulerpenyne and caulerpenyne derivatives, which are involved in protein cross-linking (Figure 1) (Weissflog et al. The average intraspecific genetic divergence was 0.025 and the average interspecific divergence was 0.17. URL, Varela-Álvarez, E., A.G. Garreta, J.R. Lluch, N.S. NJ tree based on ITS rDNA gene sequence data. The average divergence over all sequence pairs was 0.168. cylindracea f. laxa, based on morphology, and two unidentified Caulerpa sp. The additional sequences were retrieved from GenBank in order to compare the inter- and intraspecific nucleotide divergences and to produce the phylogeny of Caulerpa as complete as possible using the currently available data. The siphonous green algal taxa, particularly those belonging to the genus Caulerpa, poses considerable difficulty in taxonomic identification at the species level due to the phenotypic plasticity in diagnostic characters. Support values at nodes correspond to bootstrap proportion (BS). However, there are significant differences in the chemistry of the wound plugs between the species. This is also reflected by the maximum of caulerpenyne, which is caused by recruitment from the tissue located ca. Saunders and Kucera [36] evaluated several markers for marine green macroalgae, albeit not Caulerpa, and proposed tufA as the preferred barcode. In total, 10 clusters were recovered in NJ analysis (Figure S2). Ed. CAACCTGGTTGATCCTGCCAGT TGATCCTTCTGCAGGTTCACCTAC, GCTTATGCWAAAACATTYCAAGG AATTTCTTTCCAAACTTCACAAGC, TGAAACAGAAMAWCGTCATTATGC CCTTCNCGAATMGCRAAWCGC. 2010. as well. acknowledges the support provided by the Volkswagen Foundation. 1982. Voucher specimens for individual species were submitted to the Taxonomic Reference Centre for seaweeds at the Council of Scientific and Industrial Research-Central Salt and Marine Chemicals Research Institute (CSIR-CSMCRI). J. Adhesion 85: 825–838. Jung, V., T. Thibaut, A. Meinesz and G. Pohnert. For full functionality of this site, please enable JavaScript. Amplifications were carried out using a PCR system (Bio-Rad, Hercules, CA, USA). Morphology of Caulerpa taxifolia a: frond b: pinnules c: secondary frond d: stolon e: rhizoidal bouquet f: rhizoidal pillars g: rachis adapted from D. Chiaverini, LEML Photo: N. Coleman, World of Water Caulerpa taxifolia legislation In December 1994, scientists assigned to study the problem The other sampling locations are not the part of any national parks or protected areas and do not require any specific permits. C. serrulata and C. cupressoides were recovered as sister lineages with strong support (pp=1.0). Support values at nodes correspond to posterior probabilities (pp). In contrast, in C. prolifera, no region with spectral properties comparable to the external wound plug of C. taxifolia can be identified. The removal of the ITS1 region from the ITS rDNA dataset and the use of 5.8S-ITS2 in the phylogenetic analysis resulted in a robust and well-resolved phylogenetic tree (Figure 6). morphology of Caulerpa were those of Svedelius (1906) and Borgesen (1907). C. veravalensis was considered as a form of C. taxifolia and was later differentiated as a separate species based on morphological characters [68]. by boat anchors and its resistance to desiccation. These data points are surrounded by regions with no observed shift compared to the parent molecule caulerpenyne. Citation: Kazi MA, Reddy CRK, Jha B (2013) Molecular Phylogeny and Barcoding of Caulerpa (Bryopsidales) Based on the tufA, rbcL, 18S rDNA and ITS rDNA Genes. Raman spectroscopic insights into the chemical gradients within the wound plug of the green alga, Weissflog, J., S. Adolph, T. Wiesemeier and G. Pohnert. Jousson, O., J. Pawlowski, L. Zaninetti, F.W. This band shift is indicative of caulerpenyne-derived cross-linked material formed according to the mechanism depicted in Figure 1. A desulfatation-oxidation cascade activates coumarin-based cross-linkers in the wound reaction of the giant unicellular alga Dasycladus vermicularis. The first research aspect was field experiment which focused on assessing the growth and morphology of Caulerpa species at five different sites (Veivatuloa, Muaivusu, Namuaimada, Mana and Gunu). The wound response in the siphonous alga Caulerpa simpliciuscula C. Monterey Bay National Marine Sanctuary Fact Sheet: Caulerpa taxifolia Description: Green algae with feather-like branches, leaf is 5-65 cm in length, tropical in origin, found in Caribbean Sea and Indian Ocean, hybrid form found in Mediterranean Sea is much larger (plants up to 10 ft.), and can survive out of water for up to 10 days. Wright and A.R. [17] suggested the need for detailed study of the C. racemosa complex, which harbours a number of varieties and forms. Vienna, Austria. 28: 2091–2105. Further studies must focus on the identification of the specific compounds within both the internal and the external wound plugs. Grant. The introduced green alga. 1981. ADVERTISEMENTS: In this article we will discuss about Marchantia. Following this work, the taxa investigated in this study can be grouped into three sections, i.e. 2010, Infantes et al. Support values at nodes correspond to bootstrap proportion (BS). It can only be speculated if this efficiency might be one reason for the invasive success of C. taxifolia. The morphological development of the wound plug of Caulerpales has been well described and the fundamental biochemical transformations leading to its formation have also been characterized (Menzel 1988, Welling et al. Patterns of wide-scale substation within meadows of the seagrass. Aside from these rather general similarities, the wound plugs of C. taxifolia and C. prolifera differ distinctly. e82438. 2010. The details of the molecular markers, primers and amplification conditions utilized in this study are summarized in Table 1. How do giant plant cells cope with injury-the wound response in siphonous green algae. Similarly, C. racemosa var. Hawthorne, D.B., T.W. Specimen C14, however, with erect assimilators up to 10 cm long, and densely covered with spherical to sub-spherical ramuli and ramuli with constricted pedicels, was identified as C. lentillifera (Figure S11 in File S1). 2013). 6. Caulerpa species are eaten as delicacies in some Pacific countries, 89 and it was the search for the distinctive “peppery principle” of C. racemosa that led the initial investigation into this genus. In general, the wound plug region extends further into the tissue in C. prolifera than in C. taxifolia. denticulata (C12) and forma dwarkensis (C01) were differentiated following the treatment given by Børgesen [65]. Conceived and designed the experiments: BJ. It is circumtropical in distribution (Eubank, 1946) and is characterized by having a prostrate cylindrical rhizome with rhizoids below and … Chem.-Int. A lichen is an example of symbiosis—a relationship in which two organisms live in a close association. They are unusual because they consist of only one cell with many nuclei, making them among the biggest single cells in the world. 2010. Welling, M., C. Ross and G. Pohnert. [18] also reported the presence of six different lineages in the C. racemosa-peltata complex. 2001). The C. scalpelliformis (C21), var. 2005, Welling et al. Duraiswamy [8] categorized the Indian Caulerpa species into five sections. The rbcL gene was also found to be least variable in comparison with tufA and ITS rDNA (Figure 2). Zechman, F. Dini, G. Di Guiseppe, R. Woodfield, A. Millar and A. Meinesz. R package version 0.2. In the present study, we present a comprehensive phylogeny of Caulerpa using most of the currently available data. Discover a faster, simpler path to publishing in a high-quality journal. turbinata (as C. chemnitzia) by De Toni [9], although subsequent studies added several species. Chrysophytes (Golden-brown algae) Synedrais a bilaterally symmetrical, rod-shaped diatom. In total, 20 species including seven varieties and three forms were identified (Figures S1-S19 in File S1). The forma dwarkensis has an alternate arrangement of same-length ramuli throughout, except at the top, on regularly divided assimilators (Figure S1 in File S1). The best scheme of model substitutions for partitioned data was generated through PartitionFinder v.1.0 [63]. We also thank reviewers for their constructive comments to improve the manuscript. Analysis of the cytochrome distribution via linear and nonlinear Raman spectroscopy. Background measurements of the experimental setup without a sample revealed that neither the glue nor the holding capillaries contributed to the analyzed Raman signals. [23] for tufA-gene-based phylogenetic analysis in Caulerpa. Abstract The phenotypic plasticity and performance of two growth-forms of Caulerpa racemosa (Forssk l) J. Agardh, one found in estuarine conditions, the other growing in a coastal reef environment was studied in laboratory culture. The averaged spectrum of the wound plug of Caulerpa prolifera (A), and the external (B) and internal (C) wound plugs of C. taxifolia. Handeler et al. cylindracea f. laxa and two unidentified taxa showed close proximity with C. veravalensis at a molecular level despite the distinct morphological variations indicating the presence of a new C. veravalensis complex, which needs further detailed investigation. C. Solid lines on the right indicate possible clades. from the International Max Planck Research School for Exploration of Ecological Interactions with Molecular and Chemical Techniques of the Max Planck Institute for Chemical Ecology in Jena. Therefore, there is a need to develop an efficient DNA barcode system based on small DNA sequence amplified and sequenced from a standardized portion of the genome that is able to identify the Caulerpa species, thereby helping to explore its cryptic diversity. Montefalcone, M., G. Albertelli, C. Morri and C.N. These specimens were characterized by a pinnately divided flat broad midrib, opposite to alternate flat ramuli with a rounded apex and occasional bifurcation in apices of ramuli (Figure S9 in File S1). Reduction of herbivory through wound-activated protein cross-linking by the invasive macroalga Caulerpa taxifolia.